Review



tlcv2 backbone  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc tlcv2 backbone
    Tlcv2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+backbone/pmc12911328-37-7-9?v=Addgene+inc
    Average 96 stars, based on 131 article reviews
    tlcv2 backbone - by Bioz Stars, 2026-08
    96/100 stars

    Images



    Similar Products

    96
    Addgene inc tlcv2 backbone
    Tlcv2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+backbone/pmc12911328-37-7-9?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    tlcv2 backbone - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    93
    Addgene inc tlcv2 loxp backbone

    Tlcv2 Loxp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+backbone/pmc11982489-403-26-35?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    tlcv2 loxp backbone - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral backbone tlcv2 backbone

    Lentiviral Backbone Tlcv2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+backbone/pm40068680-486-10-14?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    lentiviral backbone tlcv2 backbone - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral backbone

    Lentiviral Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+backbone/pm37832546-655-17-21?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    lentiviral backbone - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    Addgene inc tlcv2 plasmid backbone

    Tlcv2 Plasmid Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+backbone/pmc10313372__jci___133___155938___s164-303-12-15?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    tlcv2 plasmid backbone - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment

    doi: 10.1016/j.isci.2025.112198

    Figure Lengend Snippet:

    Article Snippet: Guide sequences (non-targeting – nt-sgRNA-1: 5′- GCGGGCAGAACGACCCTGAC -3', nt-sgRNA-2: 5′- GAAGACGTGCTGGCGTCACC -3'; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) - (PAM sequence in brackets)) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098; RRID:Addgene_127098).

    Techniques: Virus, Generated, Recombinant, Membrane, Electron Microscopy, Saline, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Western Blot, RNA Sequencing, Gene Expression, Imaging, Plasmid Preparation, shRNA, Control, Luciferase, Cloning, Expressing, Software, Cell Analysis, Microscopy, Cell Culture